US4769326A
Expired / Lapsed
US
⏱️ 0.0 years remaining
Expression linkers
Assignee: University of California, San Diego
•
Filing: 1984-04-12
•
Granted: 1988-09-06
•
Expires: 2004-04-12
Abstract
Abstract The present invention is based upon a general principle of providing specific oligonucleotide segments ("linkers", herein) to be attached in sequence to a cloned DNA coding segment. The linkers of the present invention confer desired functional properties on the expression of the protein coded by the coding sequence. Using linkers of the present invention, the desired protein may be expressed either as a fusion or non-fusion protein. A linker coding for an additional sequence of amino acids may be attached, the sequence being chosen to provide properties exploitable in a simplified purification process. A linker coding for an amino acid sequence of the extended specific cleavage site of a proteolytic enzyme is provided, as well as specific cleavage linkers for simpler specific cleavage sites.
Inventors
- 👤 William J. Rutter
Bibliographic Details
Application Number
—
Jurisdiction
US
Data Source
google_patents
Last Synchronized
2026-10-23 04:40
CPC Classifications
C; C07; C07K; C07K14/00; C07K14/435; C07K14/575; C07K14/62; C12; C12N; C12N15/00; C12N15/09; C12N15/11; C12N15/62; C12N15/63; C12N15/66; C12N15/70; C07K2319/00; C07K2319/50; C07K2319/61; C07K2319/70; C07K2319/74; C07K2319/75; Y; Y10; Y10S; Y10S930/00; Y10S930/01; Y10S930/31
Claims Analysis
Total Claims: 12
Claim 1
Independent Claim
105 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence; and the third segment encodes a host peptide wherein the peptide is a polycationic peptide that is not natively associated with said eucaryotic protein.
Claim 2
Dependent Claim
105 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence; and the third segment encodes a host peptide wherein the peptide is a polycationic peptide that is not natively associated with said eucaryotic protein.
Claim 3
Dependent Claim
105 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence; and the third segment encodes a host peptide wherein the peptide is a polyanionic peptide that is not natively associated with said eucaryotic protein.
Claim 4
Dependent Claim
105 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence; and the third segment encodes a host peptide wherein the peptide is a polyanionic peptide that is not natively associated with said eucaryotic protein.
Claim 5
Dependent Claim
106 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence wherein the enzymatic reagent is enterokinase, kallikrein B, or chymosin; and the third segment encodes a host peptide not natively associated with said eucaryotic protein.
Claim 6
Dependent Claim
106 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence wherein the enzymatic reagent is enterokinase, kallikrein B, or chymosin; and the third segment encodes a host peptide not natively associated with said eucaryotic protein.
Claim 7
Dependent Claim
27 words
A DNA cleavage sequence comprising the sequence CCAAGCTTGGAGGAGGATAATTCGATGGALGALGALGALAAKGALGALGALGALAAJ, wherein L is A, T, C or G, J is A or G, and K is T or C.
Claim 8
Dependent Claim
27 words
A DNA cleavage sequence comprising the sequence CCAAGCTTGGAGGAGGATAATTCGATGGALGALGALGALAAKGALGALGALGALAAJ, wherein L is A, T, C or G, J is A or G, and K is T or C.
Claim 9
Dependent Claim
105 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence; and the third segment encodes a host peptide wherein the peptide is a hydrophobic peptide that is not natively associated with said eucaryotic protein.
Claim 10
Dependent Claim
105 words
A recombinant DNA sequence which comprises three segments not contiguous in the natural environment, wherein a first segment encodes a eucaryotic protein and is contiguous with a second segment that encodes a specific cleavage sequence of at least two amino acids, said second segment being contiguous with a third segment, wherein: the expression product of said DNA is specifically cleaved by at least one enzymatic or chemical reagent at the peptide bond linking the eucaryotic protein and the specific cleavage sequence; and the third segment encodes a host peptide wherein the peptide is a hydrophobic peptide that is not natively associated with said eucaryotic protein.
Claim 11
Dependent Claim
28 words
An expression system capable of effecting the expression of the recombinant DNA sequence of any one of claims 1, 2, 3 or 5 in a suitable host cell.
Claim 12
Dependent Claim
32 words
A method for producing a recombinant protein in mature form which method comprises culturing the cells of claim 6, recovering the expression product, and cleaving the expression product with said specific reagent.
References Cited (Backward Citations)
US4321365A
Cited
EP0001929A2
Cited
USPTO Annuity & Maintenance Windows
| Annuity Stage | Window Opens | Payment Deadline | Surcharge Period Until | Estimated Fee | Status |
|---|---|---|---|---|---|
| 3.5 Years (Year 4) | 1991-09-06 | 1992-03-07 | 1992-09-06 | $2000.00 | Window Closed / Lapsed |
| 7.5 Years (Year 8) | 1995-09-06 | 1996-03-07 | 1996-09-06 | $3760.00 | Window Closed / Lapsed |
| 11.5 Years (Year 12) | 1999-09-06 | 2000-03-07 | 2000-09-06 | $7700.00 | Window Closed / Lapsed |